Transcript: Mouse NM_001301728.1

Mus musculus ferredoxin 1 (Fdx1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Fdx1 (14148)
Length:
2827
CDS:
136..636

Additional Resources:

NCBI RefSeq record:
NM_001301728.1
NBCI Gene record:
Fdx1 (14148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177000 GCTCTACTTGTCATCTTATCT pLKO.1 482 CDS 100% 5.625 4.500 N Fdx1 n/a
2 TRCN0000178439 GAGCAGCTCAGAAGATAAGAT pLKO.1 327 CDS 100% 5.625 3.938 N Fdx1 n/a
3 TRCN0000177353 GATCACATCTATGAGAAGTTA pLKO.1 508 CDS 100% 5.625 3.938 N Fdx1 n/a
4 TRCN0000177352 GTGATTGAGAACAACTTAGAT pLKO.1 424 CDS 100% 5.625 3.938 N Fdx1 n/a
5 TRCN0000219613 GTCCACTTCAAGAACCGAGAT pLKO.1 352 CDS 100% 4.050 2.835 N Fdx1 n/a
6 TRCN0000176556 CACATCTATGAGAAGTTAGAT pLKO.1 511 CDS 100% 0.563 0.394 N Fdx1 n/a
7 TRCN0000177229 GTTGTGATTGAGAACAACTTA pLKO.1 421 CDS 100% 0.563 0.394 N Fdx1 n/a
8 TRCN0000197742 GCCATTACTGATGAAGAGAAT pLKO.1 532 CDS 100% 4.950 2.970 N Fdx1 n/a
9 TRCN0000219614 TTGGCGACTCTCTGCTAGATG pLKO.1 401 CDS 100% 4.950 2.970 N Fdx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.