Transcript: Mouse NM_001302754.1

Mus musculus engulfment and cell motility 2 (Elmo2), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Elmo2 (140579)
Length:
4538
CDS:
36..2192

Additional Resources:

NCBI RefSeq record:
NM_001302754.1
NBCI Gene record:
Elmo2 (140579)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379201 AGGACCCAGTCATCTAGTATG pLKO_005 306 CDS 100% 10.800 15.120 N Elmo2 n/a
2 TRCN0000265751 ATGTATACCAAGGACTATAAA pLKO_005 1059 CDS 100% 15.000 12.000 N Elmo2 n/a
3 TRCN0000265761 CCTAGAGAGCATGGTACTAAA pLKO_005 617 CDS 100% 13.200 10.560 N Elmo2 n/a
4 TRCN0000265758 TACGCCATTGCTCTGATTAAC pLKO_005 729 CDS 100% 13.200 10.560 N Elmo2 n/a
5 TRCN0000112638 GCCCTCTAAACCCAACTCTTT pLKO.1 1484 CDS 100% 4.950 3.960 N Elmo2 n/a
6 TRCN0000112636 CGGTCCATAATCCTGAACCAT pLKO.1 819 CDS 100% 3.000 2.400 N Elmo2 n/a
7 TRCN0000265757 TAACGCCCAGCTCCTTGAAAT pLKO_005 86 CDS 100% 13.200 9.240 N Elmo2 n/a
8 TRCN0000112639 GCCTTCTCCATCCTGTATGAT pLKO.1 1929 CDS 100% 5.625 3.938 N Elmo2 n/a
9 TRCN0000112637 CCGAGGATTTCAACAAGGTTA pLKO.1 1429 CDS 100% 4.950 3.465 N Elmo2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302754.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.