Transcript: Mouse NM_001302765.1

Mus musculus lactate dehydrogenase B (Ldhb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ldhb (16832)
Length:
1214
CDS:
112..891

Additional Resources:

NCBI RefSeq record:
NM_001302765.1
NBCI Gene record:
Ldhb (16832)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041759 CGGCATTGAGAATGAAGTCTT pLKO.1 833 CDS 100% 4.950 6.930 N Ldhb n/a
2 TRCN0000041758 CCATGTATGTAGGTCACAGTT pLKO.1 1055 3UTR 100% 4.950 3.465 N Ldhb n/a
3 TRCN0000041762 CCCAGTGGATATTCTGACTTA pLKO.1 528 CDS 100% 4.950 3.465 N Ldhb n/a
4 TRCN0000041760 CGTCATCAATCAGAAGCTGAA pLKO.1 896 3UTR 100% 4.050 2.835 N Ldhb n/a
5 TRCN0000041761 CCGAACAACAAGATCACTGTA pLKO.1 169 CDS 100% 4.950 2.970 N Ldhb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302765.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00933 pDONR223 100% 67.3% 70.6% None (many diffs) n/a
2 ccsbBroad304_00933 pLX_304 0% 67.3% 70.6% V5 (many diffs) n/a
Download CSV