Transcript: Human NM_001303139.1

Homo sapiens PDZ domain containing ring finger 3 (PDZRN3), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
PDZRN3 (23024)
Length:
3595
CDS:
354..2648

Additional Resources:

NCBI RefSeq record:
NM_001303139.1
NBCI Gene record:
PDZRN3 (23024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147485 GAAGACGACATTGGGATTTAT pLKO.1 771 CDS 100% 15.000 10.500 N PDZRN3 n/a
2 TRCN0000427656 TCAGCAACGAGTCTTTCATTT pLKO_005 1306 CDS 100% 13.200 9.240 N PDZRN3 n/a
3 TRCN0000432198 ATGATGACAGGAACGACTTTC pLKO_005 985 CDS 100% 10.800 7.560 N PDZRN3 n/a
4 TRCN0000415623 CATGAATACTACGATCCAAAT pLKO_005 627 CDS 100% 10.800 7.560 N PDZRN3 n/a
5 TRCN0000423599 GCTCGGAGCAAGAGAACAATG pLKO_005 1195 CDS 100% 10.800 7.560 N PDZRN3 n/a
6 TRCN0000183018 CGTTACTGAATGTGTTTCATA pLKO.1 3081 3UTR 100% 5.625 3.938 N PDZRN3 n/a
7 TRCN0000183332 GAGTATACAATTCCTTCCTAT pLKO.1 2611 CDS 100% 4.950 3.465 N PDZRN3 n/a
8 TRCN0000147223 GCCCATTGAAAGAATTTGCAT pLKO.1 3329 3UTR 100% 3.000 2.100 N PDZRN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.