Transcript: Human NM_001303245.2

Homo sapiens RAS p21 protein activator 2 (RASA2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RASA2 (5922)
Length:
5653
CDS:
58..2610

Additional Resources:

NCBI RefSeq record:
NM_001303245.2
NBCI Gene record:
RASA2 (5922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416189 ACAAGCAATCCGCAGTTTAAT pLKO_005 703 CDS 100% 15.000 21.000 N RASA2 n/a
2 TRCN0000420721 GAGTGAAATATGTCGAGATAA pLKO_005 1107 CDS 100% 13.200 18.480 N RASA2 n/a
3 TRCN0000002186 CCACTCTATGTCCAGGCAAAT pLKO.1 2104 CDS 100% 10.800 15.120 N RASA2 n/a
4 TRCN0000426701 TGTGAAATCGATCCTATTAAA pLKO_005 1363 CDS 100% 15.000 12.000 N RASA2 n/a
5 TRCN0000417140 GTAAAGTTCACCTTGAATTAA pLKO_005 509 CDS 100% 15.000 10.500 N RASA2 n/a
6 TRCN0000416628 AGATTGTTTCTGTACCATAAA pLKO_005 237 CDS 100% 13.200 9.240 N RASA2 n/a
7 TRCN0000421769 ATGAACTGATAACGGAGAATG pLKO_005 536 CDS 100% 10.800 7.560 N RASA2 n/a
8 TRCN0000434094 TGCTTCCTTCAGAGTACTATG pLKO_005 1016 CDS 100% 10.800 7.560 N RASA2 n/a
9 TRCN0000002184 GAACATTAACTCTCATCTCAA pLKO.1 1664 CDS 100% 4.950 3.465 N RASA2 n/a
10 TRCN0000002185 GCAGATGGCTACTCAGAGATT pLKO.1 1515 CDS 100% 4.950 3.465 N RASA2 n/a
11 TRCN0000002183 GTGACCCTTATGCAACAGTTT pLKO.1 629 CDS 100% 4.950 3.465 N RASA2 n/a
12 TRCN0000002182 GCTCAAGGAAGAACTCGGATT pLKO.1 1900 CDS 100% 4.050 2.835 N RASA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303245.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.