Transcript: Human NM_001303270.2

Homo sapiens dynein axonemal heavy chain 2 (DNAH2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DNAH2 (146754)
Length:
3011
CDS:
103..2721

Additional Resources:

NCBI RefSeq record:
NM_001303270.2
NBCI Gene record:
DNAH2 (146754)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128351 CTATCTGACTAAACCAGTGAT pLKO.1 2800 3UTR 100% 4.950 6.930 N DNAH2 n/a
2 TRCN0000131234 GCTTGTCTACTTCATTCGCCA pLKO.1 513 CDS 100% 0.660 0.924 N DNAH2 n/a
3 TRCN0000131125 GCCACAGATAACACGGAACTT pLKO.1 1599 CDS 100% 4.950 3.960 N DNAH2 n/a
4 TRCN0000146870 CAAGAATTTCACTCCCATCTT pLKO.1 2305 CDS 100% 4.950 3.465 N DNAH2 n/a
5 TRCN0000149627 GATGCCATTCTGGAACACTTT pLKO.1 397 CDS 100% 4.950 3.465 N DNAH2 n/a
6 TRCN0000146477 CTTGTCTACTTCATTCGCCAA pLKO.1 514 CDS 100% 2.160 1.512 N DNAH2 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2513 CDS 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2513 CDS 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2511 CDS 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2511 CDS 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2511 CDS 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.