Transcript: Human NM_001304263.1

Homo sapiens low density lipoprotein receptor class A domain containing 3 (LDLRAD3), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
LDLRAD3 (143458)
Length:
3764
CDS:
119..1009

Additional Resources:

NCBI RefSeq record:
NM_001304263.1
NBCI Gene record:
LDLRAD3 (143458)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153697 CGTCACCTACAACGTCAATAA pLKO.1 661 CDS 100% 13.200 18.480 N LDLRAD3 n/a
2 TRCN0000419721 GGTAGTTACCTTATAGCATTT pLKO_005 1399 3UTR 100% 10.800 15.120 N LDLRAD3 n/a
3 TRCN0000442761 ATTGGTCGCTTCCGGTGCAAT pLKO_005 227 CDS 100% 4.950 6.930 N LDLRAD3 n/a
4 TRCN0000436987 GAAGCGGAACAACCTCATGAC pLKO_005 565 CDS 100% 4.050 5.670 N LDLRAD3 n/a
5 TRCN0000119612 CCCTTCTAGTTAAGGGACTAT pLKO.1 2297 3UTR 100% 0.495 0.693 N Ldlrad3 n/a
6 TRCN0000153529 CCCTTCTAGTTAAGGGACTAT pLKO.1 2297 3UTR 100% 0.495 0.693 N LDLRAD3 n/a
7 TRCN0000419341 AGTTACAGTTTGGGATATTAA pLKO_005 1116 3UTR 100% 15.000 10.500 N LDLRAD3 n/a
8 TRCN0000151466 CAGAGAACCAACTTGTGTATT pLKO.1 456 CDS 100% 13.200 9.240 N LDLRAD3 n/a
9 TRCN0000423913 AGAATAACTGTCAAGACAACA pLKO_005 375 CDS 100% 4.950 3.465 N LDLRAD3 n/a
10 TRCN0000156628 GAACGGCCTCTGTATTGACAA pLKO.1 334 CDS 100% 4.950 3.465 N LDLRAD3 n/a
11 TRCN0000427550 AGGAAAGCTGTGAAAGTTCTC pLKO_005 402 CDS 100% 4.050 2.835 N LDLRAD3 n/a
12 TRCN0000157676 GACACGGAATCTCTGAACCAA pLKO.1 812 CDS 100% 3.000 2.100 N LDLRAD3 n/a
13 TRCN0000151145 GATGGACAGAATAACTGTCAA pLKO.1 368 CDS 100% 0.495 0.347 N LDLRAD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304263.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.