Transcript: Mouse NM_001304269.1

Mus musculus ring finger protein 4 (Rnf4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Rnf4 (19822)
Length:
2904
CDS:
255..839

Additional Resources:

NCBI RefSeq record:
NM_001304269.1
NBCI Gene record:
Rnf4 (19822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040597 GAATCTTTAGAGCCCGTGGTT pLKO.1 420 CDS 100% 2.640 3.696 N Rnf4 n/a
2 TRCN0000324050 GAATCTTTAGAGCCCGTGGTT pLKO_005 420 CDS 100% 2.640 3.696 N Rnf4 n/a
3 TRCN0000040594 CTGTTGTGATTGTTGAAGAAA pLKO.1 463 CDS 100% 5.625 3.938 N Rnf4 n/a
4 TRCN0000324051 CTGTTGTGATTGTTGAAGAAA pLKO_005 463 CDS 100% 5.625 3.938 N Rnf4 n/a
5 TRCN0000040593 CCCTTAAGAATGCTAACACTT pLKO.1 763 CDS 100% 4.950 3.465 N Rnf4 n/a
6 TRCN0000323985 CCCTTAAGAATGCTAACACTT pLKO_005 763 CDS 100% 4.950 3.465 N Rnf4 n/a
7 TRCN0000040595 CCGTCAGTTGTCCTATCTGTA pLKO.1 652 CDS 100% 4.950 3.465 N Rnf4 n/a
8 TRCN0000324048 CCGTCAGTTGTCCTATCTGTA pLKO_005 652 CDS 100% 4.950 3.465 N Rnf4 n/a
9 TRCN0000040596 GAACCCATAGAACTTGTGGAA pLKO.1 366 CDS 100% 2.640 1.848 N Rnf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.