Transcript: Human NM_001304566.1

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 1 (APOBEC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
APOBEC1 (339)
Length:
893
CDS:
25..735

Additional Resources:

NCBI RefSeq record:
NM_001304566.1
NBCI Gene record:
APOBEC1 (339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050531 CTGGAGCTGCACTGCATAATT pLKO.1 562 CDS 100% 15.000 10.500 N APOBEC1 n/a
2 TRCN0000050528 GTGGAGTAACTATTCAGATTA pLKO.1 434 CDS 100% 13.200 9.240 N APOBEC1 n/a
3 TRCN0000430470 GGTCTCAGGGACCTTGTTAAC pLKO_005 412 CDS 100% 10.800 7.560 N APOBEC1 n/a
4 TRCN0000424421 ACTGCCATTACCAAACGATTC pLKO_005 659 CDS 100% 6.000 4.200 N APOBEC1 n/a
5 TRCN0000050530 CCACCAATCACGTGGAAGTTA pLKO.1 197 CDS 100% 5.625 3.938 N APOBEC1 n/a
6 TRCN0000050532 TGGGAGTTTGACGTCTTCTAT pLKO.1 85 CDS 100% 5.625 3.938 N APOBEC1 n/a
7 TRCN0000050529 CCAGGCTATTAGAGAGTTTCT pLKO.1 315 CDS 100% 4.950 3.465 N APOBEC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.