Transcript: Human NM_001304840.3

Homo sapiens HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (HECW2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
HECW2 (57520)
Length:
11826
CDS:
971..4621

Additional Resources:

NCBI RefSeq record:
NM_001304840.3
NBCI Gene record:
HECW2 (57520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004790 CCAGGGAAGTTAAAGTTAATT pLKO.1 3539 CDS 100% 15.000 10.500 N HECW2 n/a
2 TRCN0000004791 GCACAATACTTGGAGTCAATT pLKO.1 909 5UTR 100% 13.200 9.240 N HECW2 n/a
3 TRCN0000004789 GCCCAAACATTTCTTTGAGAT pLKO.1 6268 3UTR 100% 4.950 3.465 N HECW2 n/a
4 TRCN0000004792 GCTTACAATGACAAGATTGTT pLKO.1 3140 CDS 100% 0.563 0.394 N HECW2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.