Transcript: Human NM_001306084.2

Homo sapiens cilia and flagella associated protein 54 (CFAP54), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CFAP54 (144535)
Length:
9776
CDS:
34..9324

Additional Resources:

NCBI RefSeq record:
NM_001306084.2
NBCI Gene record:
CFAP54 (144535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001306084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422356 GAACGTTGCTATGCTCAATAT pLKO_005 6151 CDS 100% 13.200 18.480 N CFAP54 n/a
2 TRCN0000148016 GCTAAAGTCGATGTTACTGAT pLKO.1 6831 CDS 100% 4.950 6.930 N CFAP54 n/a
3 TRCN0000414350 TCGTTCATCAAACACTAAATA pLKO_005 7620 CDS 100% 15.000 12.000 N CFAP54 n/a
4 TRCN0000128403 GCAGTCATATCAGCAAAGATA pLKO.1 6022 CDS 100% 5.625 4.500 N CFAP54 n/a
5 TRCN0000129720 CCTCAAGATAGAAGTCCTTAT pLKO.1 6378 CDS 100% 10.800 7.560 N CFAP54 n/a
6 TRCN0000148212 GAGAAGATAACTTGCCGAAAT pLKO.1 5488 CDS 100% 10.800 7.560 N CFAP54 n/a
7 TRCN0000147301 GCAAGAATCCTCAAGATAGAA pLKO.1 6370 CDS 100% 5.625 3.938 N CFAP54 n/a
8 TRCN0000147562 GCCCGAGAATATTTCAACATT pLKO.1 7156 CDS 100% 5.625 3.938 N CFAP54 n/a
9 TRCN0000148624 CAGACTCTCAATCAGGTTCTA pLKO.1 4802 CDS 100% 4.950 3.465 N CFAP54 n/a
10 TRCN0000128253 GCTGAGAATACAGAAGTTCAA pLKO.1 5415 CDS 100% 4.950 3.465 N CFAP54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.