Transcript: Human NM_001306212.1

Homo sapiens thrombospondin 4 (THBS4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
THBS4 (7060)
Length:
3115
CDS:
347..2959

Additional Resources:

NCBI RefSeq record:
NM_001306212.1
NBCI Gene record:
THBS4 (7060)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001306212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373683 TTTCGACCGCTTCGATAATTA pLKO_005 2938 CDS 100% 15.000 21.000 N THBS4 n/a
2 TRCN0000373760 GACCAAAGGAACAGCGATAAA pLKO_005 1661 CDS 100% 13.200 18.480 N THBS4 n/a
3 TRCN0000373761 TACTGTGATGGGACGCTTAAA pLKO_005 340 5UTR 100% 13.200 10.560 N THBS4 n/a
4 TRCN0000054048 GCGTTAATACTTTGGGATCTT pLKO.1 1254 CDS 100% 4.950 3.960 N THBS4 n/a
5 TRCN0000054052 CTTGGGTCAAATGACACAATT pLKO.1 742 CDS 100% 13.200 9.240 N THBS4 n/a
6 TRCN0000054051 CCTGAATGATCTCTATGTGAT pLKO.1 235 5UTR 100% 4.950 3.465 N THBS4 n/a
7 TRCN0000054050 CCTGAGGACTTCCAAGAGTTT pLKO.1 2906 CDS 100% 4.950 3.465 N THBS4 n/a
8 TRCN0000054049 GCCTGTGATGATGACATGGAT pLKO.1 1766 CDS 100% 3.000 1.800 N THBS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.