Transcript: Human NM_001308060.1

Homo sapiens StAR related lipid transfer domain containing 4 (STARD4), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
STARD4 (134429)
Length:
4466
CDS:
276..599

Additional Resources:

NCBI RefSeq record:
NM_001308060.1
NBCI Gene record:
STARD4 (134429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245484 AGAATTTGTTCGAGGATATAA pLKO_005 410 CDS 100% 15.000 12.000 N STARD4 n/a
2 TRCN0000147176 CGAAATCCATTTCCGTGTTTA pLKO.1 1404 3UTR 100% 13.200 10.560 N STARD4 n/a
3 TRCN0000245483 TCCTATACTGTGGGCTATAAA pLKO_005 339 CDS 100% 15.000 10.500 N STARD4 n/a
4 TRCN0000245482 GAAATCCATTTCCGTGTTTAA pLKO_005 1405 3UTR 100% 13.200 9.240 N STARD4 n/a
5 TRCN0000183423 CCAGAATTTGTTCGAGGATAT pLKO.1 408 CDS 100% 10.800 7.560 N STARD4 n/a
6 TRCN0000183003 CCGTGTTTAATGTTAGTTGTT pLKO.1 1416 3UTR 100% 4.950 3.465 N STARD4 n/a
7 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1040 3UTR 100% 1.080 0.540 Y GPR83 n/a
8 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1040 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.