Transcript: Human NM_001308207.1

Homo sapiens Rho GTPase activating protein 39 (ARHGAP39), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
ARHGAP39 (80728)
Length:
5050
CDS:
556..3807

Additional Resources:

NCBI RefSeq record:
NM_001308207.1
NBCI Gene record:
ARHGAP39 (80728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047808 CCACCGTGTATAGAGATATAA pLKO.1 4513 3UTR 100% 15.000 21.000 N ARHGAP39 n/a
2 TRCN0000047810 CTATGAGATTTACCGGGATTA pLKO.1 1101 CDS 100% 10.800 15.120 N ARHGAP39 n/a
3 TRCN0000047812 TCCCGCTTCTACTACTACAAT pLKO.1 787 CDS 100% 5.625 3.938 N ARHGAP39 n/a
4 TRCN0000047811 GAAGAGCAGAAAGCCCTCTTT pLKO.1 2037 CDS 100% 0.495 0.347 N ARHGAP39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.