Transcript: Human NM_001308248.1

Homo sapiens ecotropic viral integration site 5 (EVI5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
EVI5 (7813)
Length:
7445
CDS:
11..2476

Additional Resources:

NCBI RefSeq record:
NM_001308248.1
NBCI Gene record:
EVI5 (7813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160367 CGGATAGTAAGTCTTTAAGAT pLKO.1 303 CDS 100% 5.625 7.875 N EVI5 n/a
2 TRCN0000162442 CGAGAAGAAGAGAGTCGTATT pLKO.1 2442 CDS 100% 10.800 8.640 N EVI5 n/a
3 TRCN0000162619 CGACAGACAAAGTTGCAGAAA pLKO.1 66 CDS 100% 4.950 3.960 N EVI5 n/a
4 TRCN0000158645 CCCTTCCTGATGAGAATAATA pLKO.1 1533 CDS 100% 15.000 10.500 N EVI5 n/a
5 TRCN0000161333 GAGCAGAACAAGAGGTGATTA pLKO.1 1851 CDS 100% 13.200 9.240 N EVI5 n/a
6 TRCN0000160319 CTTTGTATGTACCAGTTTGAA pLKO.1 875 CDS 100% 5.625 3.938 N EVI5 n/a
7 TRCN0000088227 GAAGCCATTATGGGTTTGAAA pLKO.1 1601 CDS 100% 5.625 3.938 N Evi5 n/a
8 TRCN0000159452 GAGCAATAGTTTGGCAACTTT pLKO.1 516 CDS 100% 5.625 3.938 N EVI5 n/a
9 TRCN0000159840 GCAGAGATTGAATGCAAGAAT pLKO.1 1952 CDS 100% 5.625 3.938 N EVI5 n/a
10 TRCN0000161062 GCTGAGCTTGAAATCCAGAAA pLKO.1 2048 CDS 100% 4.950 3.465 N EVI5 n/a
11 TRCN0000161419 GAATGGGAAGATGTACGCAAA pLKO.1 440 CDS 100% 4.050 2.835 N EVI5 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3225 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4923 3UTR 100% 5.625 2.813 Y EID2B n/a
14 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4790 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.