Transcript: Human NM_001310121.1

Homo sapiens ataxin 2 (ATXN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ATXN2 (6311)
Length:
3993
CDS:
164..3385

Additional Resources:

NCBI RefSeq record:
NM_001310121.1
NBCI Gene record:
ATXN2 (6311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001310121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308280 CGTCAAACTGACGGATTATTA pLKO_005 3823 3UTR 100% 15.000 21.000 N ATXN2 n/a
2 TRCN0000296801 CAGCTTACTCCACGCAATATG pLKO_005 2463 CDS 100% 13.200 18.480 N ATXN2 n/a
3 TRCN0000118915 CCGAAGTGTGATTTGGTACTT pLKO.1 263 CDS 100% 4.950 3.960 N ATXN2 n/a
4 TRCN0000291185 CCGAAGTGTGATTTGGTACTT pLKO_005 263 CDS 100% 4.950 3.960 N ATXN2 n/a
5 TRCN0000118913 GCCAAGACATATAGAGCAGTA pLKO.1 2348 CDS 100% 4.050 3.240 N ATXN2 n/a
6 TRCN0000118914 GCCTCAGTCTACGATTTCTTT pLKO.1 124 5UTR 100% 5.625 3.938 N ATXN2 n/a
7 TRCN0000291127 GCCTCAGTCTACGATTTCTTT pLKO_005 124 5UTR 100% 5.625 3.938 N ATXN2 n/a
8 TRCN0000118912 GCTGGTATTATTCCAACTGAA pLKO.1 1502 CDS 100% 4.950 3.465 N ATXN2 n/a
9 TRCN0000118916 CCAGTTTATACTCAGCCTGTT pLKO.1 2234 CDS 100% 4.050 2.835 N ATXN2 n/a
10 TRCN0000291184 CCAGTTTATACTCAGCCTGTT pLKO_005 2234 CDS 100% 4.050 2.835 N ATXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.