Transcript: Mouse NM_001310144.1

Mus musculus paired box 6 (Pax6), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pax6 (18508)
Length:
3684
CDS:
361..1629

Additional Resources:

NCBI RefSeq record:
NM_001310144.1
NBCI Gene record:
Pax6 (18508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016126 GCAGACGGCATGTATGATAAA pLKO.1 775 CDS 100% 13.200 18.480 N PAX6 n/a
2 TRCN0000431235 ACGGTATCAGTTGGAACAAAT pLKO_005 1817 3UTR 100% 13.200 10.560 N Pax6 n/a
3 TRCN0000413975 CAGTGAATGGGCGGAGTTATG pLKO_005 1448 CDS 100% 10.800 8.640 N Pax6 n/a
4 TRCN0000430187 CTCAGTACTGGCCTCGATTAC pLKO_005 1604 CDS 100% 10.800 8.640 N Pax6 n/a
5 TRCN0000075374 CCACTTCAACAGGACTCATTT pLKO.1 1532 CDS 100% 13.200 9.240 N Pax6 n/a
6 TRCN0000435310 GAGTTTGAGAGGACCCATTAT pLKO_005 1042 CDS 100% 13.200 9.240 N Pax6 n/a
7 TRCN0000075375 GACGGCATGTATGATAAACTA pLKO.1 778 CDS 100% 5.625 3.938 N Pax6 n/a
8 TRCN0000075373 CCAAGTTTGTATCATTCCTTT pLKO.1 2069 3UTR 100% 4.950 3.465 N Pax6 n/a
9 TRCN0000016123 GCAAGAATACAGGTATGGTTT pLKO.1 1114 CDS 100% 4.950 3.465 N PAX6 n/a
10 TRCN0000075376 CATGGCAAACAACCTGCCTAT pLKO.1 1368 CDS 100% 4.050 2.835 N Pax6 n/a
11 TRCN0000075377 CCTGAAGCAAGAATACAGGTA pLKO.1 1108 CDS 100% 2.640 1.848 N Pax6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.