Transcript: Mouse NM_001310146.1

Mus musculus paired box 6 (Pax6), transcript variant 8, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pax6 (18508)
Length:
3485
CDS:
570..1430

Additional Resources:

NCBI RefSeq record:
NM_001310146.1
NBCI Gene record:
Pax6 (18508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310146.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016126 GCAGACGGCATGTATGATAAA pLKO.1 576 CDS 100% 13.200 18.480 N PAX6 n/a
2 TRCN0000431235 ACGGTATCAGTTGGAACAAAT pLKO_005 1618 3UTR 100% 13.200 10.560 N Pax6 n/a
3 TRCN0000413975 CAGTGAATGGGCGGAGTTATG pLKO_005 1249 CDS 100% 10.800 8.640 N Pax6 n/a
4 TRCN0000430187 CTCAGTACTGGCCTCGATTAC pLKO_005 1405 CDS 100% 10.800 8.640 N Pax6 n/a
5 TRCN0000075374 CCACTTCAACAGGACTCATTT pLKO.1 1333 CDS 100% 13.200 9.240 N Pax6 n/a
6 TRCN0000435310 GAGTTTGAGAGGACCCATTAT pLKO_005 843 CDS 100% 13.200 9.240 N Pax6 n/a
7 TRCN0000075375 GACGGCATGTATGATAAACTA pLKO.1 579 CDS 100% 5.625 3.938 N Pax6 n/a
8 TRCN0000075373 CCAAGTTTGTATCATTCCTTT pLKO.1 1870 3UTR 100% 4.950 3.465 N Pax6 n/a
9 TRCN0000016123 GCAAGAATACAGGTATGGTTT pLKO.1 915 CDS 100% 4.950 3.465 N PAX6 n/a
10 TRCN0000075376 CATGGCAAACAACCTGCCTAT pLKO.1 1169 CDS 100% 4.050 2.835 N Pax6 n/a
11 TRCN0000075377 CCTGAAGCAAGAATACAGGTA pLKO.1 909 CDS 100% 2.640 1.848 N Pax6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310146.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.