Transcript: Mouse NM_001310473.1

Mus musculus spermatogenesis associated 5 (Spata5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Spata5 (57815)
Length:
3295
CDS:
392..2920

Additional Resources:

NCBI RefSeq record:
NM_001310473.1
NBCI Gene record:
Spata5 (57815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027761 CCGGAAAGACAATGATTGCTA pLKO.1 1584 CDS 100% 3.000 4.200 N Spata5 n/a
2 TRCN0000232409 GTTGAACTTTCTAGCTATAAA pLKO_005 2449 CDS 100% 15.000 12.000 N Spata5 n/a
3 TRCN0000232406 CCAGCGCCTAGAGGGTTATTA pLKO_005 1544 CDS 100% 15.000 10.500 N Spata5 n/a
4 TRCN0000232407 GCAAGGTTACGCCAGATATTT pLKO_005 1688 CDS 100% 15.000 10.500 N Spata5 n/a
5 TRCN0000232408 GAAGTGAAGGACGGGTATTAG pLKO_005 1854 CDS 100% 13.200 9.240 N Spata5 n/a
6 TRCN0000232405 GACATGATTGGAGGCTTAAAC pLKO_005 1448 CDS 100% 13.200 9.240 N Spata5 n/a
7 TRCN0000027708 CCTTGAAACATCCTAAGTCTT pLKO.1 2328 CDS 100% 4.950 3.465 N Spata5 n/a
8 TRCN0000027703 CGGCTTGATATTCTCCAGAAA pLKO.1 1976 CDS 100% 4.950 3.465 N Spata5 n/a
9 TRCN0000027738 GCCTGGAAGAATTGACAGGAT pLKO.1 2743 CDS 100% 2.640 1.584 N Spata5 n/a
10 TRCN0000027688 CCGATCAGTAACGAGGTTGAT pLKO.1 2831 CDS 100% 4.950 6.930 N Spata5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.