Transcript: Mouse NM_001310519.1

Mus musculus pumilio RNA-binding family member 2 (Pum2), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pum2 (80913)
Length:
5868
CDS:
56..2998

Additional Resources:

NCBI RefSeq record:
NM_001310519.1
NBCI Gene record:
Pum2 (80913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233378 ATTTGTGCCAAATCCATATAT pLKO_005 955 CDS 100% 15.000 21.000 N Pum2 n/a
2 TRCN0000233377 CCTAATCCGACAGCGAATAAA pLKO_005 662 CDS 100% 15.000 21.000 N Pum2 n/a
3 TRCN0000102262 CGACCTCATATTACTACTCTT pLKO.1 2870 CDS 100% 4.950 6.930 N Pum2 n/a
4 TRCN0000233379 CTAGCTCCAACTGCCTATTAT pLKO_005 1334 CDS 100% 15.000 12.000 N Pum2 n/a
5 TRCN0000297020 CTAGCTCCAACTGCCTATTAT pLKO_005 1334 CDS 100% 15.000 12.000 N PUM2 n/a
6 TRCN0000102264 CCGCTATAATAGATCTGACAT pLKO.1 1888 CDS 100% 4.950 3.960 N Pum2 n/a
7 TRCN0000233376 TTCAATGTCCCAGCCTATTAT pLKO_005 220 CDS 100% 15.000 10.500 N Pum2 n/a
8 TRCN0000233380 TTGACTTTCTTCATCCATTTG pLKO_005 3111 3UTR 100% 10.800 7.560 N Pum2 n/a
9 TRCN0000102260 GCTGCTTTAACCATGTTCAAA pLKO.1 3012 3UTR 100% 5.625 3.938 N Pum2 n/a
10 TRCN0000102263 CGCAGTAGGTTATTGGAAGAT pLKO.1 1922 CDS 100% 4.950 3.465 N Pum2 n/a
11 TRCN0000102261 CCAGCCAATTTATTTCAGCAA pLKO.1 1097 CDS 100% 2.640 1.848 N Pum2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.