Transcript: Mouse NM_001310664.1

Mus musculus ADP-ribosyltransferase 3 (Art3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Art3 (109979)
Length:
1628
CDS:
231..1352

Additional Resources:

NCBI RefSeq record:
NM_001310664.1
NBCI Gene record:
Art3 (109979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110378 CGTGGGAAAGTTTCTTAATAA pLKO.1 857 CDS 100% 15.000 12.000 N Art3 n/a
2 TRCN0000110379 GCAGAATGGAATCGAAGTATA pLKO.1 364 CDS 100% 13.200 9.240 N Art3 n/a
3 TRCN0000110375 CCTTGGACAGACTTGACTGTA pLKO.1 1433 3UTR 100% 4.950 3.465 N Art3 n/a
4 TRCN0000110376 GCCCAGACATTTCATTCACAT pLKO.1 724 CDS 100% 4.950 3.465 N Art3 n/a
5 TRCN0000110377 CCTGACAGAATGCCAGAAATT pLKO.1 1158 CDS 100% 13.200 7.920 N Art3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310664.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.