Transcript: Mouse NM_001310666.1

Mus musculus zinc finger, MIZ-type containing 1 (Zmiz1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Zmiz1 (328365)
Length:
7516
CDS:
607..3807

Additional Resources:

NCBI RefSeq record:
NM_001310666.1
NBCI Gene record:
Zmiz1 (328365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017413 CCAGGCGTATAACAGCCAATT pLKO.1 1575 CDS 100% 10.800 15.120 N ZMIZ1 n/a
2 TRCN0000086016 CGACCTTCCAAGCAATAGCAA pLKO.1 3753 CDS 100% 3.000 2.400 N Zmiz1 n/a
3 TRCN0000414121 TACAAGCCAGAACAGTTTAAT pLKO_005 2014 CDS 100% 15.000 10.500 N ZMIZ1 n/a
4 TRCN0000086015 CCACCTGATATCAAGCCAAAT pLKO.1 2230 CDS 100% 10.800 7.560 N Zmiz1 n/a
5 TRCN0000086013 GCTCTGAAGGAAAGGAACATT pLKO.1 4727 3UTR 100% 5.625 3.938 N Zmiz1 n/a
6 TRCN0000086014 CCAAGATGTCAAACCACCTTT pLKO.1 2208 CDS 100% 4.950 3.465 N Zmiz1 n/a
7 TRCN0000017416 GCCCAATGTCATGGAGATGAT pLKO.1 3174 CDS 100% 4.950 3.465 N ZMIZ1 n/a
8 TRCN0000086017 GCCAAGATGTCAAACCACCTT pLKO.1 2207 CDS 100% 2.640 1.584 N Zmiz1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4299 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.