Transcript: Mouse NM_001310768.1

Mus musculus galactosidase, beta 1-like 2 (Glb1l2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Glb1l2 (244757)
Length:
3698
CDS:
86..1996

Additional Resources:

NCBI RefSeq record:
NM_001310768.1
NBCI Gene record:
Glb1l2 (244757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446539 ACAGGAGCTGATGGCACTAAA pLKO_005 847 CDS 100% 13.200 18.480 N Glb1l2 n/a
2 TRCN0000428713 ATGTTACCAGCTATGACTATG pLKO_005 1098 CDS 100% 10.800 15.120 N Glb1l2 n/a
3 TRCN0000174997 GCGCAAAGGTTTAATTGGAAA pLKO.1 1585 CDS 100% 4.950 6.930 N Glb1l2 n/a
4 TRCN0000193842 CCATGTTAAGAGGTTGGCATT pLKO.1 2624 3UTR 100% 4.050 5.670 N Glb1l2 n/a
5 TRCN0000175211 CCAGAACATATCATTGAGCTA pLKO.1 3187 3UTR 100% 2.640 3.696 N Glb1l2 n/a
6 TRCN0000427565 ATAGGATTCCTGGACTATAAA pLKO_005 1463 CDS 100% 15.000 12.000 N Glb1l2 n/a
7 TRCN0000330548 ATCGTGGGCGAGTCAACTATG pLKO_005 1545 CDS 100% 10.800 7.560 N GLB1L2 n/a
8 TRCN0000175187 CAAAGGAATCAACAAGGTTAT pLKO.1 1894 CDS 100% 10.800 7.560 N Glb1l2 n/a
9 TRCN0000193525 GCTGGTAGTTAAGAATAAGAA pLKO.1 3149 3UTR 100% 5.625 3.938 N Glb1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.