Transcript: Mouse NM_001311138.1

Mus musculus RIKEN cDNA 1700037H04 gene (1700037H04Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
1700037H04Rik (67326)
Length:
1321
CDS:
228..761

Additional Resources:

NCBI RefSeq record:
NM_001311138.1
NBCI Gene record:
1700037H04Rik (67326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264712 CAAGCCATAGGGAGCTCTATT pLKO_005 1075 3UTR 100% 13.200 9.240 N 1700037H04Rik n/a
2 TRCN0000263505 TCCTGCACAGGTATGAGATTA pLKO_005 415 CDS 100% 13.200 9.240 N C20orf27 n/a
3 TRCN0000264711 TCCTGCACAGGTATGAGATTA pLKO_005 415 CDS 100% 13.200 9.240 N 1700037H04Rik n/a
4 TRCN0000283130 AGAGTGACAACAGCTTCTTAG pLKO_005 373 CDS 100% 10.800 7.560 N 1700037H04Rik n/a
5 TRCN0000283134 GTGAGTACTCGGCACACAAAG pLKO_005 553 CDS 100% 10.800 7.560 N 1700037H04Rik n/a
6 TRCN0000283131 TGACTCGGAACAGAGCGATTG pLKO_005 725 CDS 100% 6.000 4.200 N 1700037H04Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12128 pDONR223 100% 87.1% 88.7% None (many diffs) n/a
2 ccsbBroad304_12128 pLX_304 0% 87.1% 88.7% V5 (many diffs) n/a
3 TRCN0000481494 TCCAACACATGATGACATGTCGAA pLX_317 88.1% 87.1% 88.7% V5 (many diffs) n/a
Download CSV