Transcript: Mouse NM_001311145.1

Mus musculus tumor necrosis factor receptor superfamily, member 22 (Tnfrsf22), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tnfrsf22 (79202)
Length:
4173
CDS:
34..630

Additional Resources:

NCBI RefSeq record:
NM_001311145.1
NBCI Gene record:
Tnfrsf22 (79202)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101345 CCAGACTAAGACAACTCTAAT pLKO.1 776 3UTR 100% 13.200 9.240 N Tnfrsf22 n/a
2 TRCN0000101347 CTGTGATAAAGATCAGGAAAT pLKO.1 348 CDS 100% 10.800 7.560 N Tnfrsf22 n/a
3 TRCN0000101346 CGCTGGTGAATACTGGTCTAA pLKO.1 180 CDS 100% 4.950 3.465 N Tnfrsf22 n/a
4 TRCN0000101348 GAGAAAGATAATTACCTGGAT pLKO.1 307 CDS 100% 2.640 1.848 N Tnfrsf22 n/a
5 TRCN0000101349 CCAGGAACATTCACAGAGAAA pLKO.1 292 CDS 100% 4.950 2.970 N Tnfrsf22 n/a
6 TRCN0000101235 GCCCTCCTTGAGAGTAAGTAA pLKO.1 1147 3UTR 100% 5.625 2.813 Y Tnfrsf23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.