Transcript: Mouse NM_001312918.1

Mus musculus epoxide hydrolase 1, microsomal (Ephx1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ephx1 (13849)
Length:
1712
CDS:
149..1474

Additional Resources:

NCBI RefSeq record:
NM_001312918.1
NBCI Gene record:
Ephx1 (13849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032646 GCACCAGAGGATAGATAGGTT pLKO.1 337 CDS 100% 3.000 4.200 N Ephx1 n/a
2 TRCN0000308463 GCACCAGAGGATAGATAGGTT pLKO_005 337 CDS 100% 3.000 4.200 N Ephx1 n/a
3 TRCN0000032644 CCACACTTTAAGACCAAGATT pLKO.1 488 CDS 100% 5.625 4.500 N Ephx1 n/a
4 TRCN0000032648 CCAGCAAGAAAGGTTTAAATT pLKO.1 729 CDS 100% 15.000 10.500 N Ephx1 n/a
5 TRCN0000308547 CCAGCAAGAAAGGTTTAAATT pLKO_005 729 CDS 100% 15.000 10.500 N Ephx1 n/a
6 TRCN0000311251 TCCACTTCATCCACGTGAAAC pLKO_005 522 CDS 100% 10.800 7.560 N Ephx1 n/a
7 TRCN0000032647 CCTGGAAGATCTGCTGACTAA pLKO.1 1156 CDS 100% 4.950 3.465 N Ephx1 n/a
8 TRCN0000305060 TTCCTTCCCAGTCATACTTAT pLKO_005 1515 3UTR 100% 13.200 7.920 N Ephx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312918.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.