Transcript: Human NM_001313726.1

Homo sapiens anoctamin 3 (ANO3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-03-01
Taxon:
Homo sapiens (human)
Gene:
ANO3 (63982)
Length:
6037
CDS:
55..3183

Additional Resources:

NCBI RefSeq record:
NM_001313726.1
NBCI Gene record:
ANO3 (63982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122093 CCAATTTAGAATATCCTCGAA pLKO.1 2102 CDS 100% 2.640 3.696 N ANO3 n/a
2 TRCN0000420368 ATGACCGATCTCGTCTCATTA pLKO_005 599 CDS 100% 13.200 10.560 N ANO3 n/a
3 TRCN0000418371 TGACATATTTGTTCGATAATG pLKO_005 1625 CDS 100% 13.200 9.240 N ANO3 n/a
4 TRCN0000139855 CCGAGCAACTGACATAGGTAT pLKO.1 2649 CDS 100% 4.950 3.465 N ANO3 n/a
5 TRCN0000121559 CCTCTGTTCAAAGATGGCAAA pLKO.1 700 CDS 100% 4.050 2.835 N ANO3 n/a
6 TRCN0000140916 CGGATGAATCAGAACACGCTA pLKO.1 575 CDS 100% 2.640 1.848 N ANO3 n/a
7 TRCN0000122460 GCTGAATATCAGGATGCCCTT pLKO.1 906 CDS 100% 2.160 1.512 N ANO3 n/a
8 TRCN0000144479 CCTCAGAATAACAGACATCTA pLKO.1 1309 CDS 100% 4.950 2.970 N ANO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.