Transcript: Mouse NM_001313957.1

Mus musculus keratin 14 (Krt14), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Krt14 (16664)
Length:
1137
CDS:
169..972

Additional Resources:

NCBI RefSeq record:
NM_001313957.1
NBCI Gene record:
Krt14 (16664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421797 GTCCTGCGCACCAAGAACTAA pLKO_005 952 CDS 100% 5.625 3.938 N Krt14 n/a
2 TRCN0000437349 TCAGTCATCCAGAGATGTGAC pLKO_005 858 CDS 100% 4.050 2.835 N Krt14 n/a
3 TRCN0000436807 ATGTCCTCCTGCAGATCGACA pLKO_005 89 5UTR 100% 2.640 1.848 N Krt14 n/a
4 TRCN0000089751 CCAATTCTCCTCATCCTCTCA pLKO.1 822 CDS 100% 2.640 1.848 N Krt14 n/a
5 TRCN0000089749 GCCCACCTTTCATCTTCCCAA pLKO.1 805 CDS 100% 2.640 1.848 N Krt14 n/a
6 TRCN0000089748 TGCTACATGCTGCTCAGGCTT pLKO.1 976 3UTR 100% 2.640 1.848 N Krt14 n/a
7 TRCN0000089750 CGAGGAGGAAATGGCCTCCAT pLKO.1 294 CDS 100% 0.088 0.062 N Krt14 n/a
8 TRCN0000090449 GCTCAGCATGAAAGCATCCTT pLKO.1 579 CDS 100% 3.000 1.500 Y LOC432604 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.