Transcript: Human NM_001313959.1

Homo sapiens AF4/FMR2 family member 1 (AFF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
AFF1 (4299)
Length:
9427
CDS:
421..4056

Additional Resources:

NCBI RefSeq record:
NM_001313959.1
NBCI Gene record:
AFF1 (4299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001313959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021976 GCACTATACACGACAGGGTTT pLKO.1 4002 CDS 100% 4.050 5.670 N AFF1 n/a
2 TRCN0000021978 CCTCCTTTGACAGCAATACAT pLKO.1 1525 CDS 100% 5.625 4.500 N AFF1 n/a
3 TRCN0000330905 CCTCCTTTGACAGCAATACAT pLKO_005 1525 CDS 100% 5.625 4.500 N AFF1 n/a
4 TRCN0000330908 TAGGTTGGGAAAGCCGAAATA pLKO_005 675 CDS 100% 13.200 9.240 N AFF1 n/a
5 TRCN0000021974 CCACTTTCTGTTGGCAACATT pLKO.1 787 CDS 100% 5.625 3.938 N AFF1 n/a
6 TRCN0000021977 CCTCCCACAAAGAATCTTCTA pLKO.1 2945 CDS 100% 4.950 3.465 N AFF1 n/a
7 TRCN0000330840 CCTCCCACAAAGAATCTTCTA pLKO_005 2945 CDS 100% 4.950 3.465 N AFF1 n/a
8 TRCN0000021975 GCCTCAAGTGAAGTTTGACAA pLKO.1 3282 CDS 100% 4.950 3.465 N AFF1 n/a
9 TRCN0000330907 GCCTCAAGTGAAGTTTGACAA pLKO_005 3282 CDS 100% 4.950 3.465 N AFF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.