Transcript: Human NM_001315537.1

Homo sapiens lactate dehydrogenase B (LDHB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
LDHB (3945)
Length:
1336
CDS:
112..1137

Additional Resources:

NCBI RefSeq record:
NM_001315537.1
NBCI Gene record:
LDHB (3945)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279641 TGCTAGATTTCGCTACCTTAT pLKO_005 615 CDS 100% 10.800 15.120 N LDHB n/a
2 TRCN0000221928 GCGTTATCAACCAGAAGCTAA pLKO.1 1019 CDS 100% 4.950 6.930 N LDHB n/a
3 TRCN0000279638 GCGTTATCAACCAGAAGCTAA pLKO_005 1019 CDS 100% 4.950 6.930 N LDHB n/a
4 TRCN0000279700 AGCTCTAGGCTGTAGAAATTT pLKO_005 1123 CDS 100% 15.000 10.500 N LDHB n/a
5 TRCN0000221925 CCAGGAATTGAATCCAGAAAT pLKO.1 747 CDS 100% 13.200 9.240 N LDHB n/a
6 TRCN0000221927 CGTGATTGGAAGTGGATGTAA pLKO.1 585 CDS 100% 5.625 3.938 N LDHB n/a
7 TRCN0000279639 CGTGATTGGAAGTGGATGTAA pLKO_005 585 CDS 100% 5.625 3.938 N LDHB n/a
8 TRCN0000221926 CCAAACAATAAGATCACTGTA pLKO.1 169 CDS 100% 4.950 3.465 N LDHB n/a
9 TRCN0000221924 GCTTATTTCTTCAGACACCTA pLKO.1 320 CDS 100% 2.640 1.848 N LDHB n/a
10 TRCN0000279698 GCTTATTTCTTCAGACACCTA pLKO_005 320 CDS 100% 2.640 1.848 N LDHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00933 pDONR223 100% 97.9% 100% None 1003_1023del n/a
2 ccsbBroad304_00933 pLX_304 0% 97.9% 100% V5 1003_1023del n/a
Download CSV