Transcript: Mouse NM_001316750.1

Mus musculus 3-ketodihydrosphingosine reductase (Kdsr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kdsr (70750)
Length:
1007
CDS:
92..895

Additional Resources:

NCBI RefSeq record:
NM_001316750.1
NBCI Gene record:
Kdsr (70750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251232 ATAACTCTGGTTGCACGAAAT pLKO_005 266 CDS 100% 10.800 15.120 N Kdsr n/a
2 TRCN0000251229 TGATGTGTCTCAAGACTATAA pLKO_005 367 CDS 100% 13.200 9.240 N Kdsr n/a
3 TRCN0000251231 CCTACTCTTCATCCAAGTTTG pLKO_005 645 CDS 100% 10.800 7.560 N Kdsr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316750.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06231 pDONR223 100% 70.2% 72.9% None (many diffs) n/a
2 ccsbBroad304_06231 pLX_304 0% 70.2% 72.9% V5 (many diffs) n/a
3 TRCN0000468609 GAGCCATCAAATCGACTAGCCAAG pLX_317 37.4% 70.2% 72.9% V5 (many diffs) n/a
Download CSV