Transcript: Human NM_001317078.1

Homo sapiens mediator complex subunit 19 (MED19), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
MED19 (219541)
Length:
1213
CDS:
94..879

Additional Resources:

NCBI RefSeq record:
NM_001317078.1
NBCI Gene record:
MED19 (219541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258189 CAGTGTCGTCTGATGCATATT pLKO_005 628 CDS 100% 13.200 18.480 N Med19 n/a
2 TRCN0000424033 GCAGTGTCGTCTGATGCATAT pLKO_005 627 CDS 100% 10.800 15.120 N MED19 n/a
3 TRCN0000053026 GAATCTGATCACACACTACAA pLKO.1 387 CDS 100% 4.950 6.930 N MED19 n/a
4 TRCN0000053023 CCCTATTCTCAGTAGCTCTTT pLKO.1 546 CDS 100% 4.950 3.960 N MED19 n/a
5 TRCN0000053024 GCCTCCCAAGAAGAAGAATAA pLKO.1 651 CDS 100% 13.200 9.240 N MED19 n/a
6 TRCN0000053025 TCTGCCTGGTTCCCATGATAA pLKO.1 495 CDS 100% 13.200 9.240 N MED19 n/a
7 TRCN0000053027 CAGTAGCTCTTTCAATCCTAT pLKO.1 555 CDS 100% 4.950 3.465 N MED19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05225 pDONR223 100% 73.6% 73.5% None (many diffs) n/a
2 ccsbBroad304_05225 pLX_304 0% 73.6% 73.5% V5 (many diffs) n/a
Download CSV