Transcript: Human NM_001317204.2

Homo sapiens CXXC finger protein 5 (CXXC5), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CXXC5 (51523)
Length:
2257
CDS:
314..1282

Additional Resources:

NCBI RefSeq record:
NM_001317204.2
NBCI Gene record:
CXXC5 (51523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219526 TCGGAACAAGAGCGGTATCAT pLKO.1 487 CDS 100% 5.625 7.875 N Cxxc5 n/a
2 TRCN0000322520 GTCGGAACAAGAGCGGTATCA pLKO_005 486 CDS 100% 4.950 6.930 N Cxxc5 n/a
3 TRCN0000139977 GACTGGCCATCAGATTTGCAA pLKO.1 1168 CDS 100% 3.000 4.200 N CXXC5 n/a
4 TRCN0000143837 CGATATTTCCAATCCTGGCTA pLKO.1 2010 3UTR 100% 2.640 3.696 N CXXC5 n/a
5 TRCN0000142729 CCTTTGATTCTTTCCGACCAT pLKO.1 1733 3UTR 100% 2.640 2.112 N CXXC5 n/a
6 TRCN0000143092 CAACAGAAGAAAGGGCTTCTT pLKO.1 2077 3UTR 100% 0.495 0.396 N CXXC5 n/a
7 TRCN0000143369 GAAAGACTGGCCATCAGATTT pLKO.1 1164 CDS 100% 13.200 9.240 N CXXC5 n/a
8 TRCN0000219528 TGGCCATCAGATTTGCAAATT pLKO.1 1171 CDS 100% 13.200 9.240 N Cxxc5 n/a
9 TRCN0000322518 TGGCCATCAGATTTGCAAATT pLKO_005 1171 CDS 100% 13.200 9.240 N Cxxc5 n/a
10 TRCN0000443009 ATTCTCTCACAGATTTCATTC pLKO_005 1394 3UTR 100% 10.800 7.560 N CXXC5 n/a
11 TRCN0000449804 CATCAGCTCCGGCAAGAAGAA pLKO_005 1069 CDS 100% 4.950 3.465 N CXXC5 n/a
12 TRCN0000142730 CCGACCATGAAATAGTGCATA pLKO.1 1746 3UTR 100% 4.950 3.465 N CXXC5 n/a
13 TRCN0000139498 CCTGGGCAAAGAATGGACAAT pLKO.1 1560 3UTR 100% 4.950 3.465 N CXXC5 n/a
14 TRCN0000144558 GAATGGACAATCAGTTTCCTT pLKO.1 1570 3UTR 100% 3.000 2.100 N CXXC5 n/a
15 TRCN0000139976 GCAGCAGTTGTAGGAATCGAA pLKO.1 1146 CDS 100% 3.000 2.100 N CXXC5 n/a
16 TRCN0000454536 GCTCTGGAGAAGGTGATGCTT pLKO_005 1229 CDS 100% 3.000 2.100 N CXXC5 n/a
17 TRCN0000447959 AGTTTGCGCAGTCCACAGAGA pLKO_005 804 CDS 100% 2.640 1.848 N CXXC5 n/a
18 TRCN0000448754 AGCATGATGGGCGGAGAGTCT pLKO_005 596 CDS 100% 0.880 0.616 N CXXC5 n/a
19 TRCN0000122415 GAAGCGGAAACGCTGCGGCAT pLKO.1 1087 CDS 100% 0.000 0.000 N CXXC5 n/a
20 TRCN0000122849 GCAGGAGCATCTCCCGCTGAT pLKO.1 841 CDS 100% 0.000 0.000 N CXXC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03325 pDONR223 98.7% 100% 100% None n/a
2 ccsbBroad304_03325 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV