Transcript: Mouse NM_001317391.1

Mus musculus LARGE xylosyl- and glucuronyltransferase 1 (Large1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Large1 (16795)
Length:
4747
CDS:
1251..3521

Additional Resources:

NCBI RefSeq record:
NM_001317391.1
NBCI Gene record:
Large1 (16795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001317391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313389 GTGCGAGTAGACTTCTATAAT pLKO_005 1830 CDS 100% 15.000 21.000 N Large1 n/a
2 TRCN0000034706 GTTCCGTTCCAACAAGCAATA pLKO.1 3398 CDS 100% 10.800 8.640 N LARGE1 n/a
3 TRCN0000093915 CCTGAGTATGATCGGAGATTT pLKO.1 3252 CDS 100% 13.200 9.240 N Large1 n/a
4 TRCN0000312358 CCTGAGTATGATCGGAGATTT pLKO_005 3252 CDS 100% 13.200 9.240 N Large1 n/a
5 TRCN0000313317 TCGTCTGTGCCGGATACAATG pLKO_005 1675 CDS 100% 10.800 7.560 N Large1 n/a
6 TRCN0000093917 CCACCTCATTGCTGATTCTAT pLKO.1 1760 CDS 100% 5.625 3.938 N Large1 n/a
7 TRCN0000312357 CCACCTCATTGCTGATTCTAT pLKO_005 1760 CDS 100% 5.625 3.938 N Large1 n/a
8 TRCN0000093914 CCTTAGCTGTTGAGAAAGTAA pLKO.1 3828 3UTR 100% 5.625 3.938 N Large1 n/a
9 TRCN0000312359 CCTTAGCTGTTGAGAAAGTAA pLKO_005 3828 3UTR 100% 5.625 3.938 N Large1 n/a
10 TRCN0000093918 CCCTAGTTTCGACATCACTAA pLKO.1 3377 CDS 100% 4.950 3.465 N Large1 n/a
11 TRCN0000093916 CCAACAAACATTACTCTGGAA pLKO.1 1885 CDS 100% 2.640 1.584 N Large1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317391.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.