Transcript: Human NM_001318370.1

Homo sapiens solute carrier family 35 member E4 (SLC35E4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
SLC35E4 (339665)
Length:
2612
CDS:
637..1341

Additional Resources:

NCBI RefSeq record:
NM_001318370.1
NBCI Gene record:
SLC35E4 (339665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434867 ATGACCTCAGCCGAAGTAGGA pLKO_005 673 CDS 100% 2.640 3.696 N SLC35E4 n/a
2 TRCN0000440793 ACTCAAGTCGGTTCAGCAAAG pLKO_005 1236 CDS 100% 6.000 4.800 N SLC35E4 n/a
3 TRCN0000044931 ACCTGGCACAACTGGTTACTA pLKO.1 1037 CDS 100% 5.625 3.938 N SLC35E4 n/a
4 TRCN0000069201 CAGCATGTCAAGCCTCAACAA pLKO.1 819 CDS 100% 4.950 3.465 N Slc35e4 n/a
5 TRCN0000303021 CAGCATGTCAAGCCTCAACAA pLKO_005 819 CDS 100% 4.950 3.465 N Slc35e4 n/a
6 TRCN0000044932 GTCAAGCCTCAACAAGTGGAT pLKO.1 825 CDS 100% 2.640 1.848 N SLC35E4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.