Transcript: Human NM_001318374.2

Homo sapiens protocadherin 9 (PCDH9), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PCDH9 (5101)
Length:
28118
CDS:
693..3791

Additional Resources:

NCBI RefSeq record:
NM_001318374.2
NBCI Gene record:
PCDH9 (5101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055938 GCGGTATATGACAACCAATAT pLKO.1 1929 CDS 100% 13.200 18.480 N PCDH9 n/a
2 TRCN0000363579 GCGGTATATGACAACCAATAT pLKO_005 1929 CDS 100% 13.200 18.480 N PCDH9 n/a
3 TRCN0000349747 ATCGTTTGGTGGTCAACATAA pLKO_005 2938 CDS 100% 13.200 9.240 N PCDH9 n/a
4 TRCN0000241634 CATCAATGTCACCGATGTAAA pLKO_005 1727 CDS 100% 13.200 9.240 N Pcdh9 n/a
5 TRCN0000312747 CATCAATGTCACCGATGTAAA pLKO_005 1727 CDS 100% 13.200 9.240 N PCDH9 n/a
6 TRCN0000055940 CCCAAGTTTACTCATAATCAT pLKO.1 2400 CDS 100% 5.625 3.938 N PCDH9 n/a
7 TRCN0000363581 CCCAAGTTTACTCATAATCAT pLKO_005 2400 CDS 100% 5.625 3.938 N PCDH9 n/a
8 TRCN0000055939 CCAACAGAATAGACAGAGAAA pLKO.1 958 CDS 100% 4.950 3.465 N PCDH9 n/a
9 TRCN0000055942 CCAGTGTTTAAAGAGGGTCAA pLKO.1 1440 CDS 100% 4.050 2.835 N PCDH9 n/a
10 TRCN0000370289 TATAGACCTCAGGTACATTAT pLKO_005 1763 CDS 100% 13.200 7.920 N PCDH9 n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 16029 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06693 pDONR223 100% 82.5% 82.2% None (many diffs) n/a
2 ccsbBroad304_06693 pLX_304 0% 82.5% 82.2% V5 (many diffs) n/a
3 TRCN0000477261 TTCGGCAAACACGATGGTGTCGAG pLX_317 10.2% 82.5% 82.2% V5 (many diffs) n/a
Download CSV