Transcript: Human NM_001320618.2

Homo sapiens glutamate ionotropic receptor kainate type subunit 1 (GRIK1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GRIK1 (2897)
Length:
3139
CDS:
497..2842

Additional Resources:

NCBI RefSeq record:
NM_001320618.2
NBCI Gene record:
GRIK1 (2897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320618.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416323 TACACCCTACGAGTGGTATAA pLKO_005 1876 CDS 100% 13.200 18.480 N GRIK1 n/a
2 TRCN0000063148 CCAGAATAGTTGGAGGGATAT pLKO.1 2022 CDS 100% 10.800 15.120 N GRIK1 n/a
3 TRCN0000063149 GCTCTCGAAGTTCCACACATA pLKO.1 701 CDS 100% 4.950 6.930 N GRIK1 n/a
4 TRCN0000063151 CCCGAGGAAGACAACAAAGAA pLKO.1 2537 CDS 100% 5.625 3.938 N GRIK1 n/a
5 TRCN0000063152 GCTTTGGATCTGGAACTCTAT pLKO.1 1118 CDS 100% 4.950 3.465 N GRIK1 n/a
6 TRCN0000100306 GCTGCCTTCTTGACAGTAGAA pLKO.1 2090 CDS 100% 4.950 3.465 N Grik1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320618.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.