Transcript: Human NM_001320630.1

Homo sapiens glutamate ionotropic receptor kainate type subunit 1 (GRIK1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GRIK1 (2897)
Length:
1817
CDS:
553..1785

Additional Resources:

NCBI RefSeq record:
NM_001320630.1
NBCI Gene record:
GRIK1 (2897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063149 GCTCTCGAAGTTCCACACATA pLKO.1 925 CDS 100% 4.950 6.930 N GRIK1 n/a
2 TRCN0000422069 TGATGCCTAACACCACATTAA pLKO_005 764 CDS 100% 13.200 9.240 N GRIK1 n/a
3 TRCN0000063152 GCTTTGGATCTGGAACTCTAT pLKO.1 1342 CDS 100% 4.950 3.465 N GRIK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.