Transcript: Human NM_001320714.1

Homo sapiens DOP1 leucine zipper like protein B (DOP1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DOP1B (9980)
Length:
7798
CDS:
189..7085

Additional Resources:

NCBI RefSeq record:
NM_001320714.1
NBCI Gene record:
DOP1B (9980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017728 CCTCCCTAAATGCCTTGTAAT pLKO.1 7547 3UTR 100% 13.200 18.480 N DOP1B n/a
2 TRCN0000017731 CCCGTCTGCTTTACTATGTTT pLKO.1 5968 CDS 100% 5.625 7.875 N DOP1B n/a
3 TRCN0000017730 CGTTGGTTTAACAGGAAGAAA pLKO.1 3267 CDS 100% 5.625 4.500 N DOP1B n/a
4 TRCN0000423818 GTTCATTGGAAGTCCATTATT pLKO_005 6153 CDS 100% 15.000 10.500 N DOP1B n/a
5 TRCN0000430421 AGAGTGGAAATTCGCTGATAA pLKO_005 1417 CDS 100% 13.200 9.240 N DOP1B n/a
6 TRCN0000420266 GACAAGATGAAACGCTATAAG pLKO_005 2685 CDS 100% 13.200 9.240 N DOP1B n/a
7 TRCN0000017732 GCTACTCTTCAGTGATTGAAA pLKO.1 235 CDS 100% 5.625 3.938 N DOP1B n/a
8 TRCN0000017729 CCAGGGATATTGAAAGTCATT pLKO.1 2766 CDS 100% 4.950 3.465 N DOP1B n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 7273 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 7273 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 7273 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.