Transcript: Human NM_001320986.2

Homo sapiens interleukin 1 receptor type 1 (IL1R1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IL1R1 (3554)
Length:
904
CDS:
353..853

Additional Resources:

NCBI RefSeq record:
NM_001320986.2
NBCI Gene record:
IL1R1 (3554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360073 ATAATGCACAAGCCATATTTA pLKO_005 717 CDS 100% 15.000 10.500 N IL1R1 n/a
2 TRCN0000360113 AGGATTCAGGACATTACTATT pLKO_005 618 CDS 100% 13.200 9.240 N IL1R1 n/a
3 TRCN0000059259 GCCATATTTAAGCAGAAACTA pLKO.1 728 CDS 100% 5.625 3.938 N IL1R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00844 pDONR223 100% 28.9% 28.6% None (many diffs) n/a
2 ccsbBroad304_00844 pLX_304 0% 28.9% 28.6% V5 (many diffs) n/a
Download CSV