Transcript: Human NM_001321307.1

Homo sapiens nuclear protein, coactivator of histone transcription (NPAT), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NPAT (4863)
Length:
6134
CDS:
103..4407

Additional Resources:

NCBI RefSeq record:
NM_001321307.1
NBCI Gene record:
NPAT (4863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143020 CCCAGTATAGTCTTAGCAGAT pLKO.1 1168 CDS 100% 4.050 5.670 N NPAT n/a
2 TRCN0000143752 CCTTAAACTGAGTGTAGGGAA pLKO.1 4452 3UTR 100% 2.640 3.696 N NPAT n/a
3 TRCN0000143516 GCATTGTCTGTGTCCCTTAAA pLKO.1 5425 3UTR 100% 13.200 10.560 N NPAT n/a
4 TRCN0000121850 GCACTAATTCATAGAACTCTT pLKO.1 5223 3UTR 100% 4.950 3.960 N NPAT n/a
5 TRCN0000276138 AGATCCATCGAGGTCATATTT pLKO_005 597 CDS 100% 15.000 10.500 N NPAT n/a
6 TRCN0000276139 AGTGTAGGGAATGGGATATTG pLKO_005 4462 3UTR 100% 13.200 9.240 N NPAT n/a
7 TRCN0000122057 CCAGTTGAAGAATTGGTTTAA pLKO.1 5535 3UTR 100% 13.200 9.240 N NPAT n/a
8 TRCN0000276196 GATTCGCTGTCTTCTACTAAA pLKO_005 1981 CDS 100% 13.200 9.240 N NPAT n/a
9 TRCN0000122165 GCTATCAAATTGCCAAGATAA pLKO.1 1875 CDS 100% 13.200 9.240 N NPAT n/a
10 TRCN0000141527 CAGCCTGCTTACTGTCCTTAT pLKO.1 245 CDS 100% 10.800 7.560 N NPAT n/a
11 TRCN0000276140 CAGCCTGCTTACTGTCCTTAT pLKO_005 245 CDS 100% 10.800 7.560 N NPAT n/a
12 TRCN0000121757 CGTTTGCAGAAATGTAAGTAA pLKO.1 4614 3UTR 100% 5.625 3.938 N NPAT n/a
13 TRCN0000143979 CCTCTGAAAGATAACACACAA pLKO.1 4174 CDS 100% 4.950 3.465 N NPAT n/a
14 TRCN0000144786 GATCCCTAATTCTGAGACTTA pLKO.1 4754 3UTR 100% 4.950 3.465 N NPAT n/a
15 TRCN0000143256 GCAGGAATGGATGTAGACAAA pLKO.1 4357 CDS 100% 4.950 2.970 N NPAT n/a
16 TRCN0000276193 GCAGGAATGGATGTAGACAAA pLKO_005 4357 CDS 100% 4.950 2.970 N NPAT n/a
17 TRCN0000144551 GTCCAGTTGAAGAATTGGTTT pLKO.1 5533 3UTR 100% 4.950 2.970 N NPAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.