Transcript: Human NM_001321417.2

Homo sapiens USH1 protein network component harmonin binding protein 1 (USHBP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
USHBP1 (83878)
Length:
3399
CDS:
234..2345

Additional Resources:

NCBI RefSeq record:
NM_001321417.2
NBCI Gene record:
USHBP1 (83878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243488 AGCTGTGCTACAGGGATACAA pLKO_005 1178 CDS 100% 5.625 7.875 N USHBP1 n/a
2 TRCN0000167417 GCTCAAATGCTTTAATCGTCT pLKO.1 1151 CDS 100% 2.640 3.696 N USHBP1 n/a
3 TRCN0000172458 CCGAGCTGAACAGGGATTTAT pLKO.1 2122 CDS 100% 15.000 10.500 N USHBP1 n/a
4 TRCN0000167371 GAGAAGCTCAAATGCTTTAAT pLKO.1 1146 CDS 100% 15.000 10.500 N USHBP1 n/a
5 TRCN0000243484 GCCGTTCTCTAATGAAGATTC pLKO_005 1537 CDS 100% 10.800 7.560 N USHBP1 n/a
6 TRCN0000243485 ACGCTGCAGAAAGAGGTTCAA pLKO_005 861 CDS 100% 4.950 3.465 N USHBP1 n/a
7 TRCN0000172363 CCTGGAGTGACATCATGTCAT pLKO.1 2403 3UTR 100% 4.950 3.465 N USHBP1 n/a
8 TRCN0000168305 GAAGACACAAATTCAGCAGGA pLKO.1 1667 CDS 100% 2.160 1.512 N USHBP1 n/a
9 TRCN0000243486 TACCCAGCCATGTCTGGACAT pLKO_005 2352 3UTR 100% 0.000 0.000 N USHBP1 n/a
10 TRCN0000243487 TGAAGGCAGCAGTGTGGATAA pLKO_005 1457 CDS 100% 10.800 5.400 Y USHBP1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3097 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321417.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.