Transcript: Human NM_001321827.2

Homo sapiens niban apoptosis regulator 3 (NIBAN3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
NIBAN3 (199786)
Length:
3679
CDS:
75..1937

Additional Resources:

NCBI RefSeq record:
NM_001321827.2
NBCI Gene record:
NIBAN3 (199786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162462 CTAACTGGATATTGGCAGCTT pLKO.1 3436 3UTR 100% 2.640 3.696 N NIBAN3 n/a
2 TRCN0000163878 CGCAGGGAGGTTTACTCATTT pLKO.1 1236 CDS 100% 13.200 9.240 N NIBAN3 n/a
3 TRCN0000160277 CAAATCTTAACTTGGTGTCAA pLKO.1 3355 3UTR 100% 4.950 3.465 N NIBAN3 n/a
4 TRCN0000164623 CTGAATCCTTGGGAGACCATA pLKO.1 490 CDS 100% 4.950 3.465 N NIBAN3 n/a
5 TRCN0000136546 CAATGATGTATCCTGCACTCT pLKO.1 1763 CDS 100% 2.640 1.848 N NIBAN3 n/a
6 TRCN0000159234 CCAAATCTTAACTTGGTGTCA pLKO.1 3354 3UTR 100% 2.640 1.848 N NIBAN3 n/a
7 TRCN0000138534 CGTGTGTTCTTGGTTCAGCTT pLKO.1 3504 3UTR 100% 2.640 1.848 N NIBAN3 n/a
8 TRCN0000159079 GCTGAAGAAATTCAAATCGGA pLKO.1 1514 CDS 100% 0.750 0.525 N NIBAN3 n/a
9 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2511 3UTR 100% 10.800 5.400 Y MRPS16 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2707 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2707 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 2746 3UTR 100% 4.050 2.025 Y ERN2 n/a
13 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2511 3UTR 100% 10.800 5.400 Y CD3EAP n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2375 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2705 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2705 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2705 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 1822 CDS 100% 2.640 1.320 Y FLJ45966 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2375 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.