Transcript: Human NM_001321834.1

Homo sapiens cleavage and polyadenylation specific factor 3 (CPSF3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CPSF3 (51692)
Length:
3538
CDS:
1486..3429

Additional Resources:

NCBI RefSeq record:
NM_001321834.1
NBCI Gene record:
CPSF3 (51692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074983 GCCTGTATATGAACTTTGAAA pLKO.1 3436 3UTR 100% 5.625 7.875 N CPSF3 n/a
2 TRCN0000291971 GCCTGTATATGAACTTTGAAA pLKO_005 3436 3UTR 100% 5.625 7.875 N CPSF3 n/a
3 TRCN0000074985 CCAGTGAATTTATTCGTGCTT pLKO.1 2579 CDS 100% 2.640 3.696 N CPSF3 n/a
4 TRCN0000291969 CCAGTGAATTTATTCGTGCTT pLKO_005 2579 CDS 100% 2.640 3.696 N CPSF3 n/a
5 TRCN0000074984 GCTGAGATTGATCTCCTATTA pLKO.1 1558 CDS 100% 13.200 9.240 N CPSF3 n/a
6 TRCN0000291972 GCTGAGATTGATCTCCTATTA pLKO_005 1558 CDS 100% 13.200 9.240 N CPSF3 n/a
7 TRCN0000074987 GCACTGATTCGAGAATATGAA pLKO.1 2662 CDS 100% 5.625 3.938 N CPSF3 n/a
8 TRCN0000291970 GCACTGATTCGAGAATATGAA pLKO_005 2662 CDS 100% 5.625 3.938 N CPSF3 n/a
9 TRCN0000074986 GCACGTTTACAGCAAGAGGTT pLKO.1 3195 CDS 100% 2.640 1.848 N CPSF3 n/a
10 TRCN0000119572 CCAGCAAACCAGTGAATTTAT pLKO.1 2571 CDS 100% 15.000 9.000 N Cpsf3 n/a
11 TRCN0000317840 CCAGCAAACCAGTGAATTTAT pLKO_005 2571 CDS 100% 15.000 9.000 N Cpsf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.