Transcript: Human NM_001321879.2

Homo sapiens histone deacetylase 9 (HDAC9), transcript variant 22, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
HDAC9 (9734)
Length:
4276
CDS:
317..1960

Additional Resources:

NCBI RefSeq record:
NM_001321879.2
NBCI Gene record:
HDAC9 (9734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195059 CAAACTGCTTTCGAAATCTAT pLKO.1 1642 CDS 100% 5.625 7.875 N HDAC9 n/a
2 TRCN0000277762 CAAACTGCTTTCGAAATCTAT pLKO_005 1642 CDS 100% 5.625 7.875 N HDAC9 n/a
3 TRCN0000004856 CGCATTCTAATTCATGAAGAT pLKO.1 1109 CDS 100% 4.950 6.930 N HDAC9 n/a
4 TRCN0000286037 CGCATTCTAATTCATGAAGAT pLKO_005 1109 CDS 100% 4.950 6.930 N HDAC9 n/a
5 TRCN0000004857 GCAAAGATTTAGCTCCAGGAT pLKO.1 1917 CDS 100% 2.640 3.696 N HDAC9 n/a
6 TRCN0000277837 GCAAAGATTTAGCTCCAGGAT pLKO_005 1917 CDS 100% 2.640 3.696 N HDAC9 n/a
7 TRCN0000196384 GAGCAGTTAATAGGCTTTAAA pLKO.1 2186 3UTR 100% 15.000 10.500 N HDAC9 n/a
8 TRCN0000277764 GAGCAGTTAATAGGCTTTAAA pLKO_005 2186 3UTR 100% 15.000 10.500 N HDAC9 n/a
9 TRCN0000174983 GCTCCAGGATTTGTAATTAAA pLKO.1 1928 CDS 100% 15.000 10.500 N Hdac9 n/a
10 TRCN0000196797 GCTCCAGGATTTGTAATTAAA pLKO.1 1928 CDS 100% 15.000 10.500 N HDAC9 n/a
11 TRCN0000277763 GCTCCAGGATTTGTAATTAAA pLKO_005 1928 CDS 100% 15.000 10.500 N HDAC9 n/a
12 TRCN0000004855 CCATCCTACAAGTACACATTA pLKO.1 908 CDS 100% 13.200 9.240 N HDAC9 n/a
13 TRCN0000195675 CCAACTGGAAGTGTTACTGAA pLKO.1 1031 CDS 100% 4.950 3.465 N HDAC9 n/a
14 TRCN0000004854 CCTAGAATCTTTGTGAGGTTT pLKO.1 3371 3UTR 100% 4.950 3.465 N HDAC9 n/a
15 TRCN0000004858 GCAAAGATAGAGGACGAGAAA pLKO.1 711 CDS 100% 4.950 3.465 N HDAC9 n/a
16 TRCN0000194057 GCAAAGATAGAGGACGAGAAA pLKO.1 711 CDS 100% 4.950 3.465 N Hdac9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.