Transcript: Human NM_001322214.1

Homo sapiens regulator of G protein signaling 3 (RGS3), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RGS3 (5998)
Length:
2116
CDS:
151..1452

Additional Resources:

NCBI RefSeq record:
NM_001322214.1
NBCI Gene record:
RGS3 (5998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432504 GAGAAGGCAGAGTGCTTATTC pLKO_005 1219 CDS 100% 13.200 18.480 N Rgs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06862 pDONR223 100% 45.3% 44.2% None (many diffs) n/a
2 ccsbBroad304_06862 pLX_304 0% 45.3% 44.2% V5 (many diffs) n/a
3 TRCN0000468623 AGCACTGCGTGATGATGACGAAGT pLX_317 15% 45.3% 44.2% V5 (many diffs) n/a
Download CSV