Transcript: Human NM_001322259.2

Homo sapiens cyclin E1 (CCNE1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CCNE1 (898)
Length:
1819
CDS:
187..1284

Additional Resources:

NCBI RefSeq record:
NM_001322259.2
NBCI Gene record:
CCNE1 (898)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428513 AGATTTCTTTGACCGGTATAT pLKO_005 696 CDS 100% 13.200 18.480 N CCNE1 n/a
2 TRCN0000045299 CCGAGCAAAGAAAGCCATGTT pLKO.1 1170 CDS 100% 4.950 6.930 N CCNE1 n/a
3 TRCN0000045302 CGACATAGAGAACTGTGTCAA pLKO.1 1017 CDS 100% 4.950 3.960 N CCNE1 n/a
4 TRCN0000413480 ACGTGCAAGCCTCGGATTATT pLKO_005 457 CDS 100% 15.000 10.500 N CCNE1 n/a
5 TRCN0000420972 GAGGTGTGTGAAGTCTATAAA pLKO_005 646 CDS 100% 15.000 10.500 N CCNE1 n/a
6 TRCN0000045298 CCTCCAAAGTTGCACCAGTTT pLKO.1 805 CDS 100% 4.950 3.465 N CCNE1 n/a
7 TRCN0000045301 GCAATTCTTCTGGATTGGTTA pLKO.1 622 CDS 100% 4.950 3.465 N CCNE1 n/a
8 TRCN0000045300 CCTTGTATCATTTCTCGTCAT pLKO.1 959 CDS 100% 4.050 2.835 N CCNE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00238 pDONR223 100% 89% 89% None 703_704ins135 n/a
Download CSV