Transcript: Human NM_001322261.2

Homo sapiens cyclin E1 (CCNE1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CCNE1 (898)
Length:
1807
CDS:
187..1272

Additional Resources:

NCBI RefSeq record:
NM_001322261.2
NBCI Gene record:
CCNE1 (898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045299 CCGAGCAAAGAAAGCCATGTT pLKO.1 1158 CDS 100% 4.950 6.930 N CCNE1 n/a
2 TRCN0000045302 CGACATAGAGAACTGTGTCAA pLKO.1 1005 CDS 100% 4.950 3.960 N CCNE1 n/a
3 TRCN0000413480 ACGTGCAAGCCTCGGATTATT pLKO_005 457 CDS 100% 15.000 10.500 N CCNE1 n/a
4 TRCN0000045298 CCTCCAAAGTTGCACCAGTTT pLKO.1 658 CDS 100% 4.950 3.465 N CCNE1 n/a
5 TRCN0000045301 GCAATTCTTCTGGATTGGTTA pLKO.1 622 CDS 100% 4.950 3.465 N CCNE1 n/a
6 TRCN0000045300 CCTTGTATCATTTCTCGTCAT pLKO.1 947 CDS 100% 4.050 2.835 N CCNE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322261.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00238 pDONR223 100% 88% 88% None 459_460ins147 n/a
Download CSV