Transcript: Human NM_001322989.2

Homo sapiens kalirin RhoGEF kinase (KALRN), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KALRN (8997)
Length:
6484
CDS:
132..5096

Additional Resources:

NCBI RefSeq record:
NM_001322989.2
NBCI Gene record:
KALRN (8997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145005 GCAGAATACGTACACCAATG pXPR_003 CGG 1777 36% 11 0.6127 KALRN KALRN 77639
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234366 GCGGAAACTCGTGACGTATTT pLKO_005 353 CDS 100% 13.200 18.480 N KALRN n/a
2 TRCN0000048211 GCTCAGAATACGTACACCAAT pLKO.1 1890 CDS 100% 4.950 6.930 N KALRN n/a
3 TRCN0000218040 ACATGAGTGAAGAGGTTAATT pLKO_005 5459 3UTR 100% 15.000 10.500 N KALRN n/a
4 TRCN0000048208 CCCGGAAGAAAGAATTTATTA pLKO.1 3940 CDS 100% 15.000 10.500 N KALRN n/a
5 TRCN0000234368 CTTCAGGACACACGAAATATG pLKO_005 4645 CDS 100% 13.200 9.240 N KALRN n/a
6 TRCN0000234369 TGATTCAAGAAAGGATCATTC pLKO_005 4837 CDS 100% 10.800 7.560 N KALRN n/a
7 TRCN0000048210 CCTGTCCAAAGGATCACCAAA pLKO.1 4344 CDS 100% 4.950 3.465 N KALRN n/a
8 TRCN0000048212 GCATATCATCTTTGGCAACAT pLKO.1 4082 CDS 100% 4.950 3.465 N KALRN n/a
9 TRCN0000048209 GCCATGAACAACATGACCTTT pLKO.1 2589 CDS 100% 4.950 3.465 N KALRN n/a
10 TRCN0000234367 GGACCTGGAGCTGGATATTAT pLKO_005 3842 CDS 100% 15.000 9.000 N KALRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.