Transcript: Human NM_001323358.1

Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 6 (ST3GAL6), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ST3GAL6 (10402)
Length:
3569
CDS:
814..1485

Additional Resources:

NCBI RefSeq record:
NM_001323358.1
NBCI Gene record:
ST3GAL6 (10402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035500 CCTTTGCACTACTATGGGAAT pLKO.1 1354 CDS 100% 4.050 3.240 N ST3GAL6 n/a
2 TRCN0000288832 CCTTTGCACTACTATGGGAAT pLKO_005 1354 CDS 100% 4.050 3.240 N ST3GAL6 n/a
3 TRCN0000035499 CGACAGTGATTCTCACTGCTT pLKO.1 1034 CDS 100% 0.264 0.211 N ST3GAL6 n/a
4 TRCN0000288762 CGACAGTGATTCTCACTGCTT pLKO_005 1034 CDS 100% 0.264 0.211 N ST3GAL6 n/a
5 TRCN0000035501 CCAGCCTTAAACCTGATTTAT pLKO.1 1132 CDS 100% 15.000 10.500 N ST3GAL6 n/a
6 TRCN0000288834 CCAGCCTTAAACCTGATTTAT pLKO_005 1132 CDS 100% 15.000 10.500 N ST3GAL6 n/a
7 TRCN0000035503 GATGAGAACATCAGCGGAATA pLKO.1 636 5UTR 100% 10.800 7.560 N ST3GAL6 n/a
8 TRCN0000288833 GATGAGAACATCAGCGGAATA pLKO_005 636 5UTR 100% 10.800 7.560 N ST3GAL6 n/a
9 TRCN0000035502 TCCTCTATTATGTACTGCATT pLKO.1 349 5UTR 100% 4.950 3.465 N ST3GAL6 n/a
10 TRCN0000288835 TCCTCTATTATGTACTGCATT pLKO_005 349 5UTR 100% 4.950 3.465 N ST3GAL6 n/a
11 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 2434 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.